SARS-CoV-2:sta on löydetty sekvenssi, joka on patentoitu Modernalle kolme vuotta ennen pandemian alkua

colorful liquids in laboratory glasswares

Covidin ainutlaatuisesta furiinin pilkkomiskohdasta piikkiproteiinissa löytyi geneettinen vastaavuus. Moderna patentoi vastaavan geenisekvenssin syöpätutkimustarkoituksiin vuonna 2017. Tutkijoiden mukaan mahdollisuus on yksi kolmesta biljoonasta (1012), että covid on kehittynyt luonnollisesti.

Patentoitu geenisekvenssi

Epäilyt siitä, että Covid-virusta on saatettu peukaloida laboratoriossa, nousivat esiin, kun tutkijat löysivät viruksen piikkiproteiinista Modernan omistamaa geneettistä materiaalia.

Tutkijat ovat tunnistaneet koodinpätkän, joka on identtinen rokotevalmistaja Modernan kolme vuotta ennen pandemiaa pantentoidun geenin osan kanssa.

Vastaavuus on löydetty SARS-CoV-2:n ainutlaatuisesta furiinin pilkkomiskohdasta, joka tekee siitä niin hyvän tartuttajan ja erottaa sen muista koronaviruksista. Rakenne on ollut yksi viruksen alkuperästä käytävän keskustelun polttopisteistä, ja jotkut tutkijat ovat väittäneet, että se ei ole voinut syntyä luonnollisesti.

Mahdollisuus luonnolliselle syntymiselle 1/100000000000

Kansainvälinen [3]tutkijaryhmä ehdottaa, että furiinin pilkkomiskohta on saattanut muuntautua laboratoriossa ihmissoluilla tehdyissä kokeissa. Heidän mukaansa mahdollisuus on yksi kolmeen biljoonaan (1012), että Modernan sekvenssi on syntynyt satunnaisesti luonnollisen evoluution kautta.

Covid-tautia aiheuttava SARS-CoV-2 kantaa kaiken sen leviämiseen tarvittavan tiedon noin 30 000 kirjaimessa geneettistä koodia, jota kutsutaan RNA:ksi.

Virus jakaa 19 kirjaimen jakson [1]Modernan omistaman geneettisen osan kanssa. Kaksitoista yhteistä kirjainta muodostaa Covidin furiinin pilkkomiskohdan rakenteen, ja loput vastaavat läheisen genomin osan nukleotideja.

Moderna jätti patentin helmikuussa 2016 osana syöpätutkimusta, kuten asiakirjoista käy ilmi. Patentoitu sekvenssi on osa MSH3-nimistä geeniä, jonka tiedetään vaikuttavan siihen, miten vahingoittuneet solut korjaavat itseään elimistössä. Se hyväksyttiin 7. maaliskuuta seuraavana vuonna

Frontiers in Virology – tutkijoiden havainto

Viimeisimmässä tutkimuksessa, joka julkaistiin [3]Frontiers in Virology -lehdessä, tutkijat vertasivat Covidin koostumusta miljooniin sekvensoituihin proteiineihin verkkotietokannassa. Virus koostuu 30 000 kirjaimesta geneettistä koodia, jotka sisältävät sen leviämiseen tarvittavaa tietoa, niin sanottuja nukleotideja.

Ainutlaatuinen virus

Se on ainoa koronavirus, jolla on 12 kirjaimesta koostuva pätkä, jonka ansiosta sen piikkiproteiini aktivoituu furiini-nimisellä entsyymillä. Sen ansiosta se voi levitä helposti ihmissolujen välillä.

Alkuperäisen Covidin genomin analyysissä havaittiin, että virus jakaa 19 kirjaimen sekvenssin Modernan omistaman geneettisen osan kanssa, jossa on yhteensä 3 300 nukleotidia.

Yhdysvaltalainen lääkejätti – Moderna

Moderna jätti [2]patentin helmikuussa 2016 osana syöpätutkimustaan. Patentoitu sekvenssi on osa MSH3-nimistä geeniä, jonka tiedetään vaikuttavan siihen, miten [4]vahingoittuneet solut korjaavat itseään elimistössä. Kaksitoista yhteistä kirjainta muodostaa Covidin furiinin pilkkomiskohdan rakenteen, ja loput vastaavat läheisen genomin osan nukleotideja.


Koodinpätkä CTCCTCGGCGGGCACGTAG on Modernan patentissa sekä SARS-CoV-2 viruksessa. Se liittyi syöpätutkimuksiin ja patentoitu osa MSH3-nimistä geeniä. Se liittyy ONKOLOGIAAN (syöpään) ja koskee syöpää aiheuttavien proteiinien valmistusta.

Lataa koko patentti

MSH3-mutaatio on erityinen sekvenssi, joka ei ole satunnainen mutaatio, vaan se on tarkoituksella lisätty syöpägeeni. Sen tarkoitus on, valitettavasti, kuten patentissa sanotaan, varmistaa onkologiaan (syöpään ) liittyvien proteiinien tuotanto. Tämän patentin (US 9587003) geenipätkä on päätynyt COVID-19 tautia aiheuttavan viruksen sisään.

Alla pantentin 11652 sekvenssi.

Merkkijono on “ctacgtgc ccgccgagga g” (kun otetaan välit pois). Saadaan: CTACGTGCCCGCCGAGGAG. Modernan patentin sekvenssi 11652.

Sitten täytyy mennä “Käänteiseen komplementtilaskuriin”:

Kirjoita laskuriin Sars-Cov-2:n geeni (CTCCTCTCGGCGGGCACGTAG):

Tämä osoittaa, että Sars-Cov-2:n sekvenssi CTCCTCGGCGGGCACGTAG vastaa Moderna-patentin sekvenssiä CTACGTGCCCGCCGCCGAGGAG ”käänteisenä komplementtinä”.

Sukelletaan vielä syvemmälle MSH3- geeniin

MSH3-geeni on jo pitkään tunnettu syöpää aiheuttavista mutaatioistaan. Tässä esimerkiksi [8]NIH (National Institutes of Health) artikkeli vuodelta 1996

Syövät aiheutuvat MSH3- geenin mutaatiosta, koska se aiheuttaa DNA-korjaukseen virheitä.

Ruotsalaistutkimus – piikkiproteiini tekee saman!

Ruotsalaiset tiedemiehet tekivät lokakuussa 2021 tutkimuksen [7]SARS-CoV-2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro

Löytö paljastaaa mahdollisen molekyylimekanismin, jolla piikkiproteiini voi haitata adaptiivista immuniteettia ja korostaa myös mRNA-rokotteiden mahdollisia sivuvaikutuksia. Piikkiproteiini estää merkittävästi DNA-vaurioiden korjausta, jota tarvitaan tehokkaaseen V(D)J-rekombinaatioon adaptiivisessa immuniteetissa. 

Piikkiproteiini sisältää Modernan vuonna 2017 patentoiman geeninpätkän, joka estää DNA-vaurioiden korjausta!

Mutta siinä ei ole vielä kaikki – valitettavasti

HI-viruksen löytämisestä Nobel-palkinnon saanut Luc Montagnier on alusta saakka sanonut, että SARS-Cov-2 sisältää pätkän HI-viruksesta. Nyt paljastuneen Modernan skandaalin johdosta paneudutaan siihen vähän lisää.

Valitettavasti Luc Montagnier on nyt [9]kuollut. Kuolema tapahtui muutamaa päivää ennen kuin hänellä oli todistusvuoro Grand Jury tapahtumassa, jossa esitellään lakimiesten toimesta todistusaineistoa maailmanlaajuisesta COVID-19 salaliitosta ja kansanmurhasta.

Onko Luc Montagnier puhunut totta?

NIH:n [9]Blast työkalulla voi etsiä sekvenssejä. Tästä operaatiosta täytyy kirjoittaa oma juttunsa. Se on monimutkainen, mutta sen voi jokainen tehdä itse hyvillä ohjeilla.

Pääpointti on kuitenkin se, että työkalulla löytyy neljä vastaavuutta HIV-sekvensseihin. Sen todennäköisyys on lähellä nollaa.

Onko SARS-Cov-2 ja mRNA-injektiot biologisia aseita?

SARS-CoV-2 viruksesta löytyy Modernan patentoima syöpäproteiinia tuottava geeninpätkä. Piikkiproteiinin on jo todettu estävän DNA-korjausta, mikä johtaa syöpään. Mahdollisuus, että se olisi joutunut sinne luonnollista tietä on äärimmäisen, mittaamattoman pieni.

SARS-CoV-2- viruksesta löytyy HI-viruksen koodinpätkää. Valitettavasti Luc Montagnier on menehtynyt. Hän kuitenkin jätti jälkeensä tiedon, millä asian saa todennettua.

Viruksesta löytyy siis kaksi erillistä koodinpätkää, jotka eivät ole tutkijoiden mukaan mitenkään (todennäköisyys 1012) voineet joutua sinne luonnollista tietä. Ne aiheuttavat 1. (MSH3) DNA-korjauksen estymistä, sitä kautta syöpäriskin kohoamista ja 2. (HIV) immuunipuolustuksen heikentymistä.

Koronarokote oli valmis jo ennen kuin pandemia ehti alkaa

[11]New York Magazinen mukaan Modernan mRNA-1273-rokote saatiin valmiiksi tammikuun 13. päivänä. Viruksen genomi oli mallinnettu Kiinassa tammikuun alussa ja julkaistu 11. päivänä. ROKOTTEEN KEHITTÄMISEEN MENI SIIS KAKSI PÄIVÄÄ! Ei muuta sanottavaa.

Ihmisiä kehotetaan HIV- testiin isoilla kampanjoilla

Maailmalla on suuria kampanjoita, joilla rohkaistaan ihmisiä HIV-testiin. Jos sinulla todetaan AIDS:iin viittaavat lymfosyyttimäärät, se ei oletettavasti johdu verisestä seksistä, vaan piikkiproteiinin aiheuttamasta immuuunikadosta.

Espanjassa Pfizer- menkat saaneet naiset kutsutaan syöpäseulontoihin (lähde: Keskustelu espanjalaisen sairaanhoitajan kanssa).

THL:n lähes reaaliaikaisen tietokannan Avohilmon tammikuun luvut olivat syöpien osalta karseat. Nyt koko tietokanta on muutettu monen vuoden osalta. Asiasta on tehty rikosilmoitus. Voit lukea siitä lisää artikkelin lopusta löytyvistä aiheeseen liittyvistä jutuista.

YLE – Wuhanin laboratoriossa tutkittiin ja muunneltiin lepakoiden koronaviruksia 

Aihetodisteet ovat jo pitkään herättäneet kysymyksiä Covidin alkuperästä ja sen yhteydestä Wuhanin virologian instituuttiin. Laitoksen tiedettiin tekevän kokeita samanlaisilla lepakoiden koronaviruskannoilla, kuin pandemian aiheuttanut kanta.

YLE kirjoitti 8.9.2021 The Intercept: Wuhanin laboratoriossa tutkittiin ja muunneltiin lepakoiden koronaviruksia – Yhdysvaltain rahoituksella

Yhteys Wuhanin laboratorioon on todistettavasti olemassa. Lepakon piikkiproteiinia on tuunattu Gain of Function- tutkimuksissa SARS-CoV virukseen. Siitä ei ole mitään epäselvää. Maailmantilanteesta johtuen on myös syytä mainita, että [10]Ukrainassa on useita BSL-3 ja BSL-4 luokan biolaboratorioita. Sellaisia, joissa SARS-CoV-2 on kehitetty.

Suuri kysymys – MIKSI?

Miksi joku haluaisi harventaa maailman väestöä? Siitähän tässä on kysymys, jos esiin nostetut seikat pitävät paikkansa.

Bill Gates, joka rahoittaa esimerkiksi WHO:ta, GAVI:a, IVI:a ([13]Hanna Nohykek istuu IVI:n hallituksessa), jotka taas määrittelevät maailmanlaajuisista rokotuksista ja maskipakoista.

Gates rahoittaa myös WEF:ia eli World Economic Forumia, jonka agendan edistäjät ovat soluttautuneet kaikkiin maailman kabinetteihin. Suomen hallituksessa istuu Marin ja Saarikko.

Bill & Melinda Gates Foundation on [14]rahoittanut 24 $ miljoonan lahjoituksella Tampereen yliopiston rokotetutkimuskeskusta (Mika Rämet toimitusjohtaja) juuri ennen pandemian puhkeamista.

Jo vuonna 2018 Gates aloitti pandemian maalaamisen. Gates omistaa tietenkin lääkeyhtiöt, sekä testaamiseen liittyvät yritykset. Koko paletin.

Sinun kannattaa katsoa CABALIN KAATUMINEN – Dokumenttisarja. Se voi antaa vastauksia näihin käsittämättömiin asioihin. Katso jaksot järjestyksessä ja varaudu tätä artikkelia huomattavasti suurempaan järkytykseen.


[1] Modified polynucleotides for the production of oncology-related proteins and peptides US9587003B2 patent

[2] US 9,587,003 B2 pdf-tiedosto

[3] MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site

[4] Ruotsalaistutkimus: Piikkiproteiinista mahdollisia haittoja DNA-korjaukseen ja adaptiiviseen immunitettiin

[5] The Intercept: Wuhanin laboratoriossa tutkittiin ja muunneltiin lepakoiden koronaviruksia – Yhdysvaltain rahoituksella

[6] Sequence 11652 from patent US 9587003

[7] SARS-CoV-2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro

[8] NIH Scientists Find Mutant Repair Gene MSH3 Has Role in Uterine Cancer

[9] HI-viruksen löytämisestä Nobel-palkinnon saanut Luc Montagnier on kuollut

[9] Basic Local Alignment Search Tool

[10] High-containment biological (high BSL) laboratories in Ukraine

[11] We Had the Vaccine the Whole Time

[12] Grand Jury

[13] IVI Hanna Nohynek

[14] Tampere University Grants

18 vastausta artikkeliin “SARS-CoV-2:sta on löydetty sekvenssi, joka on patentoitu Modernalle kolme vuotta ennen pandemian alkua

  1. Vaikea ymmärtää kuinka paljon tarkoituksellista pahuutta meistä tavallisilta näyttävistä ihmisistä löytyy ja kuinka monet uskomattomilta hyväntekeväisyysjärjestöiltä näyttäviltä tahoilta löytyy suurella rahalla ostettavia ihmisiä vailla minkäänlaista omaatuntoa!!?
    Kaikkea niin rahaa kuin teknologiaa tieteen ja tutkimuksen suurimpia saavutuksia voi käyttää hyvän tekemiseen tai hirvittävän pahan tekemiseen.
    Järkyttävää ja hyvin hyvin surullista…

  2. Meinaatko, että sekä rokotteessa että ”luonnollisessa” viruksessa on HIV riski? Molemmat ovat yhtä pahoja?

    1. En meinaa mitään. Sen näyttää tulevaisuus. Tämä vuosi.

      1. Koska aiempi kommenttini ei näy niin kommentoin varalta uudestaan. Kirjoitit: ”Alla pantentin sekvenssi ja CTCCTCGGCGGGCACGTAG korostettuna.”, mutta korostetussa merkkijonossa kolmas kirjain on a eikä c, eikä merkkijono muutenkaan ole kovinkaan lähellä CTCCTCGGCGGGCACGTAG:tä. Mistä on kyse?

      2. Tähän on lisätty selitys ja linkki ”käänteiseen komplementtilaskuriin.”

      3. En ole ottanut yhtään covid piikkejä, nyt yritän parantua kyseisestä taudista. Sillä mietin, jos tästä sairastetusta taudista saa vielä hivin kaupan päälle niin johan on! Sitä kun en valitettavasti onnistunut kaikesta huolimatta väistämään.. onko täällä kohta millään mitään väliä??

  3. ”Alla pantentin sekvenssi ja CTCCTCGGCGGGCACGTAG korostettuna.” -Öh, eihän tuo korostettu merkkijono ole sama?? Esim. kolmas kirjain korostuksessa on a eikä c.

    1. Tähän on lisätty selitys ja linkki ”käänteiseen komplementtilaskuriin.”

  4. Yksi pikku juttu – on etsitty kirjainryhmä, mutta löydetty ihan eri kirjainryhmä?

    ctcctcgg cgggcacgta g : tätä etsitty
    ctacgtgc ccgccgagga g : tämä korostettu löydettynä?

    1. Tähän on lisätty selitys ja linkki ”käänteiseen komplementtilaskuriin.”

  5. Voisko olla niin, että toi virus olis mutatoitunut jo niin paljon, että sen asevoima on laantunu…🤔

  6. Voisko olla niin, että toi virus olis mutatoitunut jo niin paljon, että sen asevoima on laantunu…🤔.

  7. Grafeenia, abortoitujen sikiöiden soluja, hiv-geenejä, piikkiproteiinia syövän kasvua edistämään, mitä kaikkea edes enää muistakaan…eli voidaan todeta tutkittu ja turvallinen rokote. Tänään oli isot mainostaulut kaupungilla että koko perhe kerralla saa haettua rokotteen ilman ajanvarausta.

  8. Miten Suomen johtavissa asemissa olevat päättäjät ja virkamiehet voivat olla niin uskollisia suurelle suunnitelmalle vähentää populaatiota ihan ensimmäisten joukossa ja odottaa siitä kunniaa ja kiitosta itselleen hyvin hoidetusta työstä??!!
    Meitä selkärankaisia hyväntahtoisen valtion hellään huolenpitoon sinisilmäisesti uskovia perheitä on paljon.
    Kahden vuoden mittaisen tarkoin suunnitellun aivopesun tulos on toteutunut paremmin kuin hyvin.
    Maailmalta kuuluu tutkimustuloksia tästä turvallisesta rokotteesta, joka kylvää sairautta kärsimystä ja ennenaikaisia kuolemia!
    Meillä niitä niitä vielä mainostetaan suurin julistein! ”Tulkaa ja ottakaa tämä turvallinen rokote, niin vältytte kuolemalta!”

  9. Lisää mRNAinjektiopiikkejä on odotettavissa, myös näihin koronapiikeillä sekä 5G mikroaalto säteilyllä aikaansaatuihin ’tauteihin’ ja sairauksiin. EU johtaja Ursulan ajama pakollinen rokotepassi koko EUhun olisi kuulemma tulossa jo 1.heinäkuussa (tietoa löytyy mm. hollantilaisen median sivuilta). Suomen perustuslakihan on muokattu valmiiksi jo 2012 silloisen WEF agentoidun hallituksemme/eduskunnan toimesta, niin että EU lait menevät perustuslakimme edelle. Samaan aikaan, kun veivät pressalta valtaoikeudet. Eli myivät lopullisesti Suomen itsenäisyyden (rahalla, kiristettyinä???)

    USAn rokotetsaari Fauci ja MODeRNAn johtaja (tuon firman nimihän viittaa jo suoraan RNAn muokkaukseen…) esittelivät globalistiEliitilleen bioase eli mRNArokotearsenaaliaan tammikuun WEF etätapaamisessa ja pohdiskelivat, millä kivalla myrkkypiikillään jatkaisivat maailman väestön massamurhaamistaan. Tässä kirjoituksessa lisää aiheesta

  10. Olen itse jättänyt rokotteet ottamatta, mutta monet tuttavat ovat ottaneet ne. Onko tullut vastaan mitään tutkimusta tai tietoa, miten aineen saisi elimistöstä pois tai parantaa immuniteettia?

    1. Aasiassa on klinikka, joka on siihen erikoistunut. Pyrimme saamaan tiedon suomalaisille. En sano vielä ainetta, joka on osallisena siihen, koska se oletettavasti kielletään Suomessa nopealla aikataululla, jos sen kertoo ääneen. Se on vielä vapaasti tilattavissa. Jo muutaman viikon kuluttua luultavasti olemme siinä pisteessä, että detox systeemin voi tuoda esiin.
